neuron specific paav hsyn dsredexpress Search Results


93
Addgene inc neuron specific paav hsyn dsredexpress
Neuron Specific Paav Hsyn Dsredexpress, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neuron specific paav hsyn dsredexpress/product/Addgene inc
Average 93 stars, based on 1 article reviews
neuron specific paav hsyn dsredexpress - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Obio Technology Corp Ltd paav9-camkiiα-hm3d (gq)mcherry
Paav9 Camkiiα Hm3d (Gq)Mcherry, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paav9-camkiiα-hm3d (gq)mcherry/product/Obio Technology Corp Ltd
Average 90 stars, based on 1 article reviews
paav9-camkiiα-hm3d (gq)mcherry - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
Addgene inc neurons
Neurons, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neurons/product/Addgene inc
Average 95 stars, based on 1 article reviews
neurons - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

91
Addgene inc neuron specific hsyn promoter
Neuron Specific Hsyn Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neuron specific hsyn promoter/product/Addgene inc
Average 91 stars, based on 1 article reviews
neuron specific hsyn promoter - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

92
Addgene inc dopamine neuron specific grin2a knockout
a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- <t>Grin2a</t> KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.
Dopamine Neuron Specific Grin2a Knockout, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dopamine neuron specific grin2a knockout/product/Addgene inc
Average 92 stars, based on 1 article reviews
dopamine neuron specific grin2a knockout - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

96
Addgene inc neuron specific promoter paav5 hsyn hm4d gi mcherry
a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- <t>Grin2a</t> KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.
Neuron Specific Promoter Paav5 Hsyn Hm4d Gi Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neuron specific promoter paav5 hsyn hm4d gi mcherry/product/Addgene inc
Average 96 stars, based on 1 article reviews
neuron specific promoter paav5 hsyn hm4d gi mcherry - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
Addgene inc cpn neurons
a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- <t>Grin2a</t> KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.
Cpn Neurons, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpn neurons/product/Addgene inc
Average 94 stars, based on 1 article reviews
cpn neurons - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Addgene inc interneuron specific hdlx enhancer element
a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- <t>Grin2a</t> KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.
Interneuron Specific Hdlx Enhancer Element, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/interneuron specific hdlx enhancer element/product/Addgene inc
Average 93 stars, based on 1 article reviews
interneuron specific hdlx enhancer element - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

96
Addgene inc paav hsyn dio mcherry
a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- <t>Grin2a</t> KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.
Paav Hsyn Dio Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paav hsyn dio mcherry/product/Addgene inc
Average 96 stars, based on 1 article reviews
paav hsyn dio mcherry - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results


a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Timeline of tissue collection ages for juvenile (P21), adolescent (P35, P45), and adult (P80) samples. b, Prefrontal cortex (PFC) and hippocampus showed no effect of adolescence on normalized GluN2A levels. c, Ventral Tegmental Area (VTA) showed significant effect of age, with reductions in normalized GluN2A at P21 vs P45 (* p =0.0157) and vs P80 (** p =0.0058). The substantia nigra (SN) also showed an effect of age with reductions from P21 vs P35 (** p =0.0036), vs P45 (* p =0.0318), and vs P80 (** p =0.0033); ( n =5-6 brains). Significance testing: one-way ANOVA; Dunnett post hoc. d, Correlation between adolescent emergence of psychosis and midbrain GluN2A loss during adolescence. e, Experimental design. f, Representative image showing GFP overlap with hemagglutinin (HA)-tagged CRISPR/Cas9 virus, quantification shows significantly more cells expressed both GFP and HA than only GFP (*** p =0.0002) or with only HA (*** p =0.0001). g, Representative image showing GFP overlap with dopaminergic cells, quantification shows significantly with more cells expressed both GFP and tyrosine hydroxylase (TH) than only GFP (* p =0.0152); ( n =3 brains). Significance testing: one-way ANOVA; Tukey post hoc. h, Experimental design and example traces of slice electrophysiology experiments in adolescent brain. i, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were significantly less effected by TCN201 than controls (* p =0.049); (control n =9, DA- Grin2a KO n =11 cells). j, Quantification of peak amplitudes showed dopamine cells in DA- Grin2a KO brains were similarly affected by ifenprodil as controls; (control n =9, DA- Grin2a KO n = 10 cells). k, Western blot analysis of adult brain tissue showed a significant reduction of normalized GluN2A in the VTA of DA- Grin2a KO animals compared to controls (** p =0.0082); (control n =4, DA- Grin2a KO n =3 brains). Significance testing: unpaired t-test. Error bars denote ±SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: CRISPR, Virus, Control, Western Blot

a, Progressive Ratio experimental design. b,c,d, Data collected during the FR1 and FR5 sessions show no group differences in initial operant performance. Cue-action latency (b), action-reward latency (c), and total trials completed (d) were similar between groups. e, DA-Grin2a KO animals showed no differences in breakpoint from controls across the four progressive ratio (PR) testing days. f, There was a significant interaction between treatment and ratio requirement (** p =0.0065) in average post-reinforcement pause (PRP), post hoc analysis revealed control animals increased their PRPs when the response requirement increased FR2 vs FR77 (*** p =0.0005) and vs FR95 (**** p <0.0001). This was not seen in the DA-Grin2a KO animals; (control n =10, DA- Grin2a KO n =10 rats). Significance testing: two-way ANOVA: Sidak post hoc. Error bars denote ± SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Progressive Ratio experimental design. b,c,d, Data collected during the FR1 and FR5 sessions show no group differences in initial operant performance. Cue-action latency (b), action-reward latency (c), and total trials completed (d) were similar between groups. e, DA-Grin2a KO animals showed no differences in breakpoint from controls across the four progressive ratio (PR) testing days. f, There was a significant interaction between treatment and ratio requirement (** p =0.0065) in average post-reinforcement pause (PRP), post hoc analysis revealed control animals increased their PRPs when the response requirement increased FR2 vs FR77 (*** p =0.0005) and vs FR95 (**** p <0.0001). This was not seen in the DA-Grin2a KO animals; (control n =10, DA- Grin2a KO n =10 rats). Significance testing: two-way ANOVA: Sidak post hoc. Error bars denote ± SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Control

a, Flexible Conditioning Learning experimental design. b, Discrimination index (DI) over sessions and averaged across sessions were used a behavioral readout for the FCL task. Both treatment groups responded to CS A similarly, increasing food trough entries relative to baseline during CS presentation, then decreasing once the value of CS A was switched on Session 6. c, DI over sessions and averaged across sessions in response to CS B . There were no significant differences between treatment groups in response to CS B over all sessions, but when DIs were pooled across initial learning (Session 1-5) and reversal (Session 6-10) DA- Grin2a KO animals had significantly higher DIs than controls after the contingency switch (* p =0.0204). d, Summary of Pavlovian learning models applied to FCL data. e, Models were fit to data from the initial learning (Sessions 1-5) of the positive association (CS A ). Average and individual values (symbols) for change in model fit between Rescorla Wagner (RW) and Pearce-Hall (PH). Values <0 indicate a better fit from PH mechanisms >0 indicate a better fit from RW. These models fit the initial learning data with similar accuracy. f, Actual (thin lines) and predicted (bold lines) DIs for the best fit model for each group recovered no differences in behavioral trajectories over initial learning between groups. g, Models were fit to data from contingency reversal learning (Session 6-10) of the positive association (CS B ). Average and individual values (symbols) for change in model fit between RW and PH. RW model better fit data from DA- Grin2a KO animals while PH better fit control data (** p =0.0016). h, Actual (thin lines) and predicted (thick lines) DIs for the best fit model for each group recovered differences in behavioral trajectories over learning between groups; (control n = 6, DA- Grin2a KO n = 5 rats). Significance testing: unpaired t-test. Error bars and shading denote ± SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Flexible Conditioning Learning experimental design. b, Discrimination index (DI) over sessions and averaged across sessions were used a behavioral readout for the FCL task. Both treatment groups responded to CS A similarly, increasing food trough entries relative to baseline during CS presentation, then decreasing once the value of CS A was switched on Session 6. c, DI over sessions and averaged across sessions in response to CS B . There were no significant differences between treatment groups in response to CS B over all sessions, but when DIs were pooled across initial learning (Session 1-5) and reversal (Session 6-10) DA- Grin2a KO animals had significantly higher DIs than controls after the contingency switch (* p =0.0204). d, Summary of Pavlovian learning models applied to FCL data. e, Models were fit to data from the initial learning (Sessions 1-5) of the positive association (CS A ). Average and individual values (symbols) for change in model fit between Rescorla Wagner (RW) and Pearce-Hall (PH). Values <0 indicate a better fit from PH mechanisms >0 indicate a better fit from RW. These models fit the initial learning data with similar accuracy. f, Actual (thin lines) and predicted (bold lines) DIs for the best fit model for each group recovered no differences in behavioral trajectories over initial learning between groups. g, Models were fit to data from contingency reversal learning (Session 6-10) of the positive association (CS B ). Average and individual values (symbols) for change in model fit between RW and PH. RW model better fit data from DA- Grin2a KO animals while PH better fit control data (** p =0.0016). h, Actual (thin lines) and predicted (thick lines) DIs for the best fit model for each group recovered differences in behavioral trajectories over learning between groups; (control n = 6, DA- Grin2a KO n = 5 rats). Significance testing: unpaired t-test. Error bars and shading denote ± SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Control

a,b, DA- Grin2a KO animals showed no significant differences from control animals in time spent in the center of the Open Field or in general locomotor activity; (control n =9, DA- Grin2a KO n =8 rats. c,d, Control and DA- Grin2a KO animals showed similar percent time spent in either the open or closed arms of the Elevated Plus Maze; (control n =9, DA- Grin2a KO n =8 rats. e,f , DA- Grin2a KO animals had no significant differences from controls in percent alternation or total arm entries in the Plus Maze; (control n =5, DA- Grin2a KO n =8 rats). Significance testing: unpaired t-test. Error bars denote ± SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a,b, DA- Grin2a KO animals showed no significant differences from control animals in time spent in the center of the Open Field or in general locomotor activity; (control n =9, DA- Grin2a KO n =8 rats. c,d, Control and DA- Grin2a KO animals showed similar percent time spent in either the open or closed arms of the Elevated Plus Maze; (control n =9, DA- Grin2a KO n =8 rats. e,f , DA- Grin2a KO animals had no significant differences from controls in percent alternation or total arm entries in the Plus Maze; (control n =5, DA- Grin2a KO n =8 rats). Significance testing: unpaired t-test. Error bars denote ± SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Control, Activity Assay

a, Virus infusion and fiber implant experiment. b, Example image of fiber placement into the Nucleus Accumbens core (AcbC). c, Fiber photometry recording during Flexible Contingency Learning task. d , Representative heatmaps of first 25 presentations of CS A and CS B during Session 1. e, Average fluorescent signal in first 25 presentations of either CSduring Session 1, binned into 5 trial sections. f, Quantification of average z-score across 2 s following CS A or CS B onset showed reduction in response from first 5 presentations to final 25 presentations. Both control and DA- Grin2a KO animals’ responses fell similarly; (control N = 5, DA- Grin2a KO N = 6 rats). Significance testing: two-way ANOVA. Error bars and shading denote ±SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Virus infusion and fiber implant experiment. b, Example image of fiber placement into the Nucleus Accumbens core (AcbC). c, Fiber photometry recording during Flexible Contingency Learning task. d , Representative heatmaps of first 25 presentations of CS A and CS B during Session 1. e, Average fluorescent signal in first 25 presentations of either CSduring Session 1, binned into 5 trial sections. f, Quantification of average z-score across 2 s following CS A or CS B onset showed reduction in response from first 5 presentations to final 25 presentations. Both control and DA- Grin2a KO animals’ responses fell similarly; (control N = 5, DA- Grin2a KO N = 6 rats). Significance testing: two-way ANOVA. Error bars and shading denote ±SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Virus, Control

a, Average fluorescence response during the final 25 CS A presentations of Session 1, all 50 CS A presentations of Session 5, final 25 presentations of Session 6, and all 50 CSA presentations of Session 10. b, Quantification of average z-scores during P1. Control animals showed increased average z-score during Session 5 in P1 compared to DA- Grin2a KO animals (**** p <0.0001). c, Control animals had higher mid CS A z-scores than DA- Grin2a KO animals (**** p <0.0001). d, There was no difference between groups during P3. e, Average fluorescence response during the final 25 CS B presentations of Session 1, all 50 CS B presentations of Session 5, final 25 presentations of CSB in Session 6, and all 50 CSB presentations of Session 10. f, Quantification of average z-scores during P1. Control animals showed increased average z-score during Session 5 in P1 compared to DA- Grin2a KO animals (* p =0.042) and then rose to higher levels by Session 10 (**** p <0.0001). g, Control animals had higher mid CS B z-scores than DA- Grin2a KO animals (** p =0.0041). h, There was no difference between groups during P3; Session1, Session 6: control n = 125 CS A/B trials ( N = 5 rats), DA- Grin2a KO n = 150 CS A/B trials ( N = 6 rats). Session 5, Session 10: control n = 250 CS A/B trials ( N = 5 rats), DA- Grin2a KO n = 300 CS A/B trials ( N = 6 rats). Significance testing: two-way ANOVA: Sidak post hoc. Error bars and shading denote ± SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Average fluorescence response during the final 25 CS A presentations of Session 1, all 50 CS A presentations of Session 5, final 25 presentations of Session 6, and all 50 CSA presentations of Session 10. b, Quantification of average z-scores during P1. Control animals showed increased average z-score during Session 5 in P1 compared to DA- Grin2a KO animals (**** p <0.0001). c, Control animals had higher mid CS A z-scores than DA- Grin2a KO animals (**** p <0.0001). d, There was no difference between groups during P3. e, Average fluorescence response during the final 25 CS B presentations of Session 1, all 50 CS B presentations of Session 5, final 25 presentations of CSB in Session 6, and all 50 CSB presentations of Session 10. f, Quantification of average z-scores during P1. Control animals showed increased average z-score during Session 5 in P1 compared to DA- Grin2a KO animals (* p =0.042) and then rose to higher levels by Session 10 (**** p <0.0001). g, Control animals had higher mid CS B z-scores than DA- Grin2a KO animals (** p =0.0041). h, There was no difference between groups during P3; Session1, Session 6: control n = 125 CS A/B trials ( N = 5 rats), DA- Grin2a KO n = 150 CS A/B trials ( N = 6 rats). Session 5, Session 10: control n = 250 CS A/B trials ( N = 5 rats), DA- Grin2a KO n = 300 CS A/B trials ( N = 6 rats). Significance testing: two-way ANOVA: Sidak post hoc. Error bars and shading denote ± SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Fluorescence, Control

a, Average fluorescence response during the first 25 (Early) and final 25 (Late) CS A trials. b, Quantification of average z-score across 2 s time periods at CS onset (P1), mid CS (P2), and US onset (P3). Control animals had significantly higher responses than DA- Grin2a KOs in Early trials during P1 that fell by Late trials (left) (*** p =0.0009). This difference was sustained through P2 (middle) (**** p <0.0001) and P3 (right) (**** p <0.0001). c, Average fluorescence response during the first 25 (Early) and final 25 (Late) CS B trials. d, Quantification of average z-score during P1, P2, and P3. There were no differences during P1 (left) or P2 (middle). Control animals had significantly higher responses to the unexpected shock during Early trials that normalized by Late trials (**** p <0.0001) (right); Early Session 6: control n =125 CS A/B trials ( N =5 rats), DA- Grin2a KO n =150 CS A/B trials ( N =6 rats). Late Session 6: control n =125 CS A/B trials ( N =5 rats), DA- Grin2a KO n =150 CS A/B trials ( N =6 rats). Significance testing: two-way ANOVA: Sidak post hoc. The data are represented as mean ± SEM.

Journal: bioRxiv

Article Title: Reductions of Grin2a in adolescent dopamine neurons confers aberrant salience and related psychosis phenotype

doi: 10.1101/2024.10.28.620713

Figure Lengend Snippet: a, Average fluorescence response during the first 25 (Early) and final 25 (Late) CS A trials. b, Quantification of average z-score across 2 s time periods at CS onset (P1), mid CS (P2), and US onset (P3). Control animals had significantly higher responses than DA- Grin2a KOs in Early trials during P1 that fell by Late trials (left) (*** p =0.0009). This difference was sustained through P2 (middle) (**** p <0.0001) and P3 (right) (**** p <0.0001). c, Average fluorescence response during the first 25 (Early) and final 25 (Late) CS B trials. d, Quantification of average z-score during P1, P2, and P3. There were no differences during P1 (left) or P2 (middle). Control animals had significantly higher responses to the unexpected shock during Early trials that normalized by Late trials (**** p <0.0001) (right); Early Session 6: control n =125 CS A/B trials ( N =5 rats), DA- Grin2a KO n =150 CS A/B trials ( N =6 rats). Late Session 6: control n =125 CS A/B trials ( N =5 rats), DA- Grin2a KO n =150 CS A/B trials ( N =6 rats). Significance testing: two-way ANOVA: Sidak post hoc. The data are represented as mean ± SEM.

Article Snippet: Viruses in these experiments were: AAV1-FLEX-Cas9-U6-sgGrin2a for dopamine neuron-specific Grin2a knockout (DA- Grin2a KO) (Addgene, # 124850) which targets the first conserved exon (exon 6) across splice variants in both rat and mouse (sgRNA: 5’ GAGCAGGCAACCGGCTTGCCC 3’).

Techniques: Fluorescence, Control